Primer sets

assay forward reverse gene region target_group amplicon_size reference link
folmer_COI LCO1490 HCO2198 COI metazoa 658 Folmer et al. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. https://doi.org/10.1186/1472-6785-13-34
geller_COI jgLCO1490 jgHCO2198 COI metazoa Geller et al. 2013. Redesign of PCR primers for mitochondrial Cytochrome c oxidase subunit I for marine invertebrates and application in all-taxa biotic surveys. https://doi.org/10.1111/1755-0998.12138
leray_COI mlCOIintF jgHCO2198 COI metazoa 313 Leray et al. 2013. A new versatile primer set targeting a short fragment of the mitochondrial COI region for metabarcoding metazoan diversity: application for characterizing coral reef fish gut contents. https://doi.org/10.1186/1742-9994-10-34
lobo_COI LoboF1 LoboR1 COI metazoa Lobo et al. 2013. Enhanced primers for amplification of DNA barcodes from a broad range of marine metazoans. https://doi.org/10.1186/1472-6785-13-34
MiFish-U MiFish-U-F MiFish-U-R 12S fish 163-185 Miya et al. 2015. MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. https://doi.org/10.1098/rsos.150088
MiFish-E MiFish-E-F MiFish-E-R 12S elasmobranchs 163-185 Miya et al. 2015. MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. https://doi.org/10.1098/rsos.150088
MiFish-U/E MiFish-U/E-F MiFish-U/E-R 12S fish Miya et al. 2015. MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. https://doi.org/10.1098/rsos.150088
MiMammal-U MiMammal-U-F MiMammal-U-R 12S mammals Ushio et al. 2017. Environmental DNA enables detection of terrestrial mammals from forest pond water. https://doi.org/10.1111/1755-0998.12690
MiMammal-E MiMammal-E-F MiMammal-E-R 12S elephants Ushio et al. 2017. Environmental DNA enables detection of terrestrial mammals from forest pond water. https://doi.org/10.1111/1755-0998.12690
MiMammal-B MiMammal-B-F MiMammal-B-R 12S bears Ushio et al. 2017. Environmental DNA enables detection of terrestrial mammals from forest pond water. https://doi.org/10.1111/1755-0998.12690
valentini_12S L1848 H1913 12S amphibians, fish Valentini et al. 2016. Next-generation monitoring of aquatic biodiversity using environmental DNA metabarcoding. https://doi.org/10.1111/mec.13428
Vert-16S-eDNA Vert-16S-eDNA-F1 Vert-16S-eDNA-R1 16S amphibians, fish 250 Vences et al. 2016. Freshwater vertebrate metabarcoding on Illumina platforms using double-indexed primers of the mitochondrial 16S rRNA gene. https://doi.org/10.1007/s12686-016-0550-y
amaral_zettler_18S 1389F 1510R 18S V9 protists Amaral-Zettler et al. 2009. A Method for Studying Protistan Diversity Using Massively Parallel Sequencing of V9 Hypervariable Regions of Small-Subunit Ribosomal RNA Genes. https://doi.org/10.1371/journal.pone.0006372
fwh1 fwhF1 fwhR1 COI invertebrates 178 Vamos et al. 2017. Short COI markers for freshwater macroinvertebrate metabarcoding. https://doi.org/10.3897/mbmg.1.14625
fwh2 fwhF2 fwhR2 COI invertebrates 205 Vamos et al. 2017. Short COI markers for freshwater macroinvertebrate metabarcoding. https://doi.org/10.3897/mbmg.1.14625
16S_FishSyn_Short 16S_FishSyn_Short_forward 16S_FishSyn_Short_reverse 16S 80 Nester et al. 2020. Development and evaluation of fish eDNA metabarcoding assays facilitate the detection of cryptic seahorse taxa (family: Syngnathidae). https://doi.org/10.1002/edn3.93
16S_FishSyn_Long 16S_FishSyn_Long_forward 16S_FishSyn_Long_reverse 16S 200 Nester et al. 2020. Development and evaluation of fish eDNA metabarcoding assays facilitate the detection of cryptic seahorse taxa (family: Syngnathidae). https://doi.org/10.1002/edn3.93
MiDeca MiDeca-F MiDeca-R mt16S 153–184 Komai et al. 2019. Development of a new set of PCR primers for eDNA metabarcoding decapod crustaceans. https://doi.org/10.3897/mbmg.3.33835
prie_veneroida prie_veneroida_F prie_veneroida_R 16S venerid clams Prié et al. 2020. Environmental DNA metabarcoding for freshwater bivalves biodiversity assessment: methods and results for the Western Palearctic (European sub-region). https://doi.org/10.1007/s10750-020-04260-8
wilderlab_BE 1380F 1510R 18S V9 100-150 Wilkinson et al. 2024. TICI: a taxon-independent community index for eDNA-based ecological health assessment. https://doi.org/10.7717/peerj.16963
wilderlab_BU 1389F 1510R 18S V9 protists 80-150, 167 Wilkinson et al. 2024. TICI: a taxon-independent community index for eDNA-based ecological health assessment. https://doi.org/10.7717/peerj.16963
wilderlab_CI wilderlab_fwhF2 wilderlab_coi_reverse COI invertebrates 76 Wilkinson et al. 2024. TICI: a taxon-independent community index for eDNA-based ecological health assessment. https://doi.org/10.7717/peerj.16963
wilderlab_MZ rbcL19b wilderlab_rbclZ1 rbcL 105 Wilkinson et al. 2024. TICI: a taxon-independent community index for eDNA-based ecological health assessment. https://doi.org/10.7717/peerj.16963
wilderlab_RV 12S–V5-F 12S–V5-R mt12S vertebrates 97-103, 73-110 Wilkinson et al. 2024. TICI: a taxon-independent community index for eDNA-based ecological health assessment. https://doi.org/10.7717/peerj.16963
wilderlab_HD MiDeca-F MiDeca-R mt16S crustaceans 153–184, 115-150 Wilkinson et al. 2024. TICI: a taxon-independent community index for eDNA-based ecological health assessment. https://doi.org/10.7717/peerj.16963
wilderlab_TP A49425 B49466 trnL vascular plants 25-80, 35–150 Wilkinson et al. 2024. TICI: a taxon-independent community index for eDNA-based ecological health assessment. https://doi.org/10.7717/peerj.16963
wilderlab_GV wilderlab_GV_F wilderlab_GV_R ITS1 vascular plants 200-300 Wilkinson et al. 2024. TICI: a taxon-independent community index for eDNA-based ecological health assessment. https://doi.org/10.7717/peerj.16963
wilderlab_UM F785e 907R 16S V5 bacteria 96-108, 100-105 Wilkinson et al. 2024. TICI: a taxon-independent community index for eDNA-based ecological health assessment. https://doi.org/10.7717/peerj.16963
wilderlab_WV wilderlab_WV_F wilderlab_WV_R mt16S vertebrates 35-150 Wilkinson et al. 2024. TICI: a taxon-independent community index for eDNA-based ecological health assessment. https://doi.org/10.7717/peerj.16963
wilderlab_LG wilderlab_LG_F MiFish-U-R mt12S fish 110-115 Wilkinson et al. 2024. TICI: a taxon-independent community index for eDNA-based ecological health assessment. https://doi.org/10.7717/peerj.16963
wilderlab_BX 18S_1F 18S_400R 18S V1-V3 eukaryotes 390-410 Wilkinson et al. 2024. TICI: a taxon-independent community index for eDNA-based ecological health assessment. https://doi.org/10.7717/peerj.16963
wilderlab_WG wilderlab_WG_F wilderlab_WG_R 16S venerid clams 120-140 Wilkinson et al. 2024. TICI: a taxon-independent community index for eDNA-based ecological health assessment. https://doi.org/10.7717/peerj.16963
wilderlab_EA wilderlab_EA_F wilderlab_EA_R COI freshwater mussels Wilkinson et al. 2024. TICI: a taxon-independent community index for eDNA-based ecological health assessment. https://doi.org/10.7717/peerj.16963
wilderlab_XG wilderlab_XG_F wilderlab_XG_R COI bullies Wilkinson et al. 2024. TICI: a taxon-independent community index for eDNA-based ecological health assessment. https://doi.org/10.7717/peerj.16963
wilderlab_GF Fung02_F Fung02_R ITS1 fungi 98-150 https://doi.org/10.1111/j.1365-294x.2012.05537.x https://doi.org/10.7717/peerj.16963
wilderlab_XO platypus Wilkinson et al. 2024. TICI: a taxon-independent community index for eDNA-based ecological health assessment. https://doi.org/10.7717/peerj.16963
wilderlab_GD SCLER5.8SFor SCLER28SRev ITS2 cnidaria 250-500 Wilkinson et al. 2024. TICI: a taxon-independent community index for eDNA-based ecological health assessment. https://doi.org/10.7717/peerj.16963
wilderlab_ZP wilderlab_ZP_F wilderlab_ZP_R 16S Wilkinson et al. 2024. TICI: a taxon-independent community index for eDNA-based ecological health assessment. https://doi.org/10.7717/peerj.16963
wilderlab_ZC wilderlab_ZC_F wilderlab_ZC_R mt16S 80-150
wilderlab_YG wilderlab_YG_F wilderlab_YG_R cytB Wilkinson et al. 2024. TICI: a taxon-independent community index for eDNA-based ecological health assessment. https://doi.org/10.7717/peerj.16963
wilderlab_GC ITS2 basal metazoans 250-450 Wilkinson et al. 2024. TICI: a taxon-independent community index for eDNA-based ecological health assessment. https://doi.org/10.7717/peerj.16963
wilderlab_DG wilderlab_DG_F wilderlab_DG_R mt16S 40-150
wilderlab_LV wilderlab_LV_F wilderlab_LV_R 12S 100-165
CoralTTS2 SCLER5.8SFor SCLER28SRev ITS2 scleractinia Alexander et al. 2019. Development of a multi-assay approach for monitoring coral diversity using eDNA metabarcoding. https://doi.org/10.1007/s00338-019-01875-9
CoralTTS2_acro SCLER5.8SFor Coralacro_874Rev ITS2 porifera Alexander et al. 2019. Development of a multi-assay approach for monitoring coral diversity using eDNA metabarcoding. https://doi.org/10.1007/s00338-019-01875-9
Sponge16S Sponge16S_377For Sponge16S_583Rev 16S porifera Alexander et al. 2019. Development of a multi-assay approach for monitoring coral diversity using eDNA metabarcoding. https://doi.org/10.1007/s00338-019-01875-9
wilderlab_LM MarVer1F MarVer1R 12S mammals Valsecchi et al. 2020. Novel universal primers for metabarcoding environmental DNA surveys of marine mammals and other marine vertebrates. https://doi.org/10.1002/edn3.72
MarVer1 MarVer1F MarVer1R 12S vertebrates 199–212 Valsecchi et al. 2020. Novel universal primers for metabarcoding environmental DNA surveys of marine mammals and other marine vertebrates. https://doi.org/10.1002/edn3.72
MarVer3 MarVer3F MarVer3R 16S vertebrates 232-274 Valsecchi et al. 2020. Novel universal primers for metabarcoding environmental DNA surveys of marine mammals and other marine vertebrates. https://doi.org/10.1002/edn3.72

Primers

code name gene region target_group direction sequence based_on reference link
LCO1490 COI metazoa forward GGTCAACAAATCATAAAGATATTGG Folmer et al. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. https://doi.org/10.1186/1472-6785-13-34
HC02198 COI metazoa reverse TAAACTTCAGGGTGACCAAAAAATCA Folmer et al. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. https://doi.org/10.1186/1472-6785-13-34
jgLCO1490 COI metazoa forward TITCIACIAAYCAYAARGAYATTGG LCO1490 Geller et al. 2013. Redesign of PCR primers for mitochondrial Cytochrome c oxidase subunit I for marine invertebrates and application in all-taxa biotic surveys. https://doi.org/10.1111/1755-0998.12138
jgHCO2198 COI metazoa reverse TAIACYTCIGGRTGICCRAARAAYCA HC02198 Geller et al. 2013. Redesign of PCR primers for mitochondrial Cytochrome c oxidase subunit I for marine invertebrates and application in all-taxa biotic surveys. https://doi.org/10.1111/1755-0998.12138
mlCOIintF COI metazoa forward GGWACWGGWTGAACWGTWTAYCCYCC Leray et al. 2013. A new versatile primer set targeting a short fragment of the mitochondrial COI region for metabarcoding metazoan diversity: application for characterizing coral reef fish gut contents. https://doi.org/10.1186/1742-9994-10-34
LoboF1 COI metazoa forward KBTCHACAAAYCAYAARGAYATHGG Lobo et al. 2013. Enhanced primers for amplification of DNA barcodes from a broad range of marine metazoans. https://doi.org/10.1186/1472-6785-13-34
LoboR1 COI metazoa reverse TAAACYTCWGGRTGWCCRAARAAYCA Lobo et al. 2013. Enhanced primers for amplification of DNA barcodes from a broad range of marine metazoans. https://doi.org/10.1186/1472-6785-13-34
MiFish-U-F 12S fish forward GTCGGTAAAACTCGTGCCAGC Miya et al. 2015. MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. https://doi.org/10.1098/rsos.150088
MiFish-U-R 12S fish reverse CATAGTGGGGTATCTAATCCCAGTTTG Miya et al. 2015. MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. https://doi.org/10.1098/rsos.150088
MiFish-E-F 12S elasmobranchs forward GTTGGTAAATCTCGTGCCAGC Miya et al. 2015. MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. https://doi.org/10.1098/rsos.150088
MiFish-E-R 12S elasmobranchs reverse CATAGTGGGGTATCTAATCCTAGTTTG Miya et al. 2015. MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. https://doi.org/10.1098/rsos.150088
MiFish-U/E-F 12S fish forward GTYGGTAAAWCTCGTGCCAGC Miya et al. 2015. MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. https://doi.org/10.1098/rsos.150088
MiFish-U/E-R 12S fish reverse CATAGTGGGGTATCTAATCCYAGTTTG Miya et al. 2015. MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. https://doi.org/10.1098/rsos.150088
MiMammal-U-F 12S mammals forward GGGTTGGTAAATTTCGTGCCAGC Ushio et al. 2017. Environmental DNA enables detection of terrestrial mammals from forest pond water. https://doi.org/10.1111/1755-0998.12690
MiMammal-U-R 12S mammals reverse CATAGTGGGGTATCTAATCCCAGTTTG Ushio et al. 2017. Environmental DNA enables detection of terrestrial mammals from forest pond water. https://doi.org/10.1111/1755-0998.12690
MiMammal-E-F 12S elephants forward GGACTGGTCAATTTCGTGCCAGC Ushio et al. 2017. Environmental DNA enables detection of terrestrial mammals from forest pond water. https://doi.org/10.1111/1755-0998.12690
MiMammal-E-R 12S elephants reverse CATAGTGAGGTATCTAATCTCAGTTTG Ushio et al. 2017. Environmental DNA enables detection of terrestrial mammals from forest pond water. https://doi.org/10.1111/1755-0998.12690
MiMammal-B-F 12S bears forward GGGTTGGTTAATTTCGTGCCAGC Ushio et al. 2017. Environmental DNA enables detection of terrestrial mammals from forest pond water. https://doi.org/10.1111/1755-0998.12690
MiMammal-B-R 12S bears reverse CATAGTGGGGTATCTAATCCCAGTTTG Ushio et al. 2017. Environmental DNA enables detection of terrestrial mammals from forest pond water. https://doi.org/10.1111/1755-0998.12690
L1848 teleo_F 12S amphibians, fish forward ACACCGCCCGTCACTCT Valentini et al. 2016. Next-generation monitoring of aquatic biodiversity using environmental DNA metabarcoding. https://doi.org/10.1111/mec.13428
H1913 teleo_R 12S amphibians, fish reverse CTTCCGGTACACTTACCATG Valentini et al. 2016. Next-generation monitoring of aquatic biodiversity using environmental DNA metabarcoding. https://doi.org/10.1111/mec.13428
Vert-16S-eDNA-F1 16S amphibians, fish forward AGACGAGAAGACCCYdTGGAGCTT Vences et al. 2016. Freshwater vertebrate metabarcoding on Illumina platforms using double-indexed primers of the mitochondrial 16S rRNA gene. https://doi.org/10.1007/s12686-016-0550-y
Vert-16S-eDNA-R1 16S amphibians, fish reverse GATCCAACATCGAGGTCGTAA Vences et al. 2016. Freshwater vertebrate metabarcoding on Illumina platforms using double-indexed primers of the mitochondrial 16S rRNA gene. https://doi.org/10.1007/s12686-016-0550-y
1380F 18S V9 protists forward CCCTGCCHTTTGTACACAC Amaral-Zettler et al. 2009. A Method for Studying Protistan Diversity Using Massively Parallel Sequencing of V9 Hypervariable Regions of Small-Subunit Ribosomal RNA Genes. https://doi.org/10.1371/journal.pone.0006372
1389F 18S V9 forward TTGTACACACCGCCC Amaral-Zettler et al. 2009. A Method for Studying Protistan Diversity Using Massively Parallel Sequencing of V9 Hypervariable Regions of Small-Subunit Ribosomal RNA Genes. https://doi.org/10.1371/journal.pone.0006372
1510R 18S V9 protists reverse CCTTCYGCAGGTTCACCTAC Amaral-Zettler et al. 2009. A Method for Studying Protistan Diversity Using Massively Parallel Sequencing of V9 Hypervariable Regions of Small-Subunit Ribosomal RNA Genes. https://doi.org/10.1371/journal.pone.0006372
fwhF1 COI invertebrates forward YTCHACWAAYCAYAARGAYATYGG LCO1490 Vamos et al. 2017. Short COI markers for freshwater macroinvertebrate metabarcoding. https://doi.org/10.3897/mbmg.1.14625
fwhR1 COI invertebrates reverse ARTCARTTWCCRAAHCCHCC ZBJ-ArtR2c Vamos et al. 2017. Short COI markers for freshwater macroinvertebrate metabarcoding. https://doi.org/10.3897/mbmg.1.14625
fwhF2 COI invertebrates forward GGDACWGGWTGAACWGTWTAYCCHCC mlCOIintF Vamos et al. 2017. Short COI markers for freshwater macroinvertebrate metabarcoding. https://doi.org/10.3897/mbmg.1.14625
fwhR2 COI invertebrates reverse GTRATWGCHCCDGCAARWACWGG ArR5 Vamos et al. 2017. Short COI markers for freshwater macroinvertebrate metabarcoding. https://doi.org/10.3897/mbmg.1.14625
fwhR2n COI invertebrates reverse GTRATWGCHCCDGCTARWACWGG ArR5 Vamos et al. 2017. Short COI markers for freshwater macroinvertebrate metabarcoding. https://doi.org/10.3897/mbmg.1.14625
wilderlab_fwhF2 COI forward DACWGGWTGAACWGTWTAYCCHCC fwhF2 Wilkinson et al. 2024. TICI: a taxon-independent community index for eDNA-based ecological health assessment. https://doi.org/10.7717/peerj.16963
wilderlab_coi_reverse COI reverse GTTGTAATAAAATTAAYDGCYCCTARAATDGA Wilkinson et al. 2024. TICI: a taxon-independent community index for eDNA-based ecological health assessment. https://doi.org/10.7717/peerj.16963
rbcL19b rbcL forward CTTCTTCAGGTGGAACTCCAG Bradley et al. 2007. Plant DNA sequences from feces: potential means for assessing diets of wild primates. https://doi.org/10.1002/ajp.20384
rbclZ1 rbcL reverse ATGTCACCACAAACAGAGACTAAAGCAAGT Bradley et al. 2007. Plant DNA sequences from feces: potential means for assessing diets of wild primates. https://doi.org/10.1002/ajp.20384
wilderlab_rbclZ1 rbcL reverse GTCACCACAAACAGAGACTAAAGCAAGT rbclZ1 Wilkinson et al. 2024. TICI: a taxon-independent community index for eDNA-based ecological health assessment. https://doi.org/10.7717/peerj.16963
12S–V5-F 12S V5 forward TTAGATACCCCACTATGC Riaz et al. 2001. ecoPrimers: Inference of new DNA barcode markers from whole genome sequence analysis. https://doi.org/10.1093/nar/gkr732
12S–V5-R 12S V5 reverse TAGAACAGGCTCCTCTAG Riaz et al. 2001. ecoPrimers: Inference of new DNA barcode markers from whole genome sequence analysis. https://doi.org/10.1093/nar/gkr732
MiDeca-F 16S forward GGACGATAAGACCCTATAAA Komai et al. 2019. Development of a new set of PCR primers for eDNA metabarcoding decapod crustaceans. https://doi.org/10.3897/mbmg.3.33835
MiDeca-R 16S reverse ACGCTGTTATCCCTAAAGT Komai et al. 2019. Development of a new set of PCR primers for eDNA metabarcoding decapod crustaceans. https://doi.org/10.3897/mbmg.3.33835
A49325 trnL forward CGAAATCGGTAGACGCTACG Taberlet et al. 2006. Power and limitations of the chloroplast Trn L (UAA) intron for plant DNA barcoding. https://doi.org/10.1093/nar/gkl938
B49863 trnL reverse GGGGATAGAGGGACTTGAAC Taberlet et al. 2006. Power and limitations of the chloroplast Trn L (UAA) intron for plant DNA barcoding. https://doi.org/10.1093/nar/gkl938
A49425 trnL forward GGGCAATCCTGAGCCAA Taberlet et al. 2006. Power and limitations of the chloroplast Trn L (UAA) intron for plant DNA barcoding. https://doi.org/10.1093/nar/gkl938
B49466 trnL reverse CCATTGAGTCTCTGCACCTATC Taberlet et al. 2006. Power and limitations of the chloroplast Trn L (UAA) intron for plant DNA barcoding. https://doi.org/10.1093/nar/gkl938
wilderlab_GV_F ITS1 forward GTGAACCTGCGGAAGGATC Wilkinson et al. 2024. TICI: a taxon-independent community index for eDNA-based ecological health assessment. https://doi.org/10.7717/peerj.16963
wilderlab_GV_R ITS1 reverse GATATCCGTTGCCGAGAGTC Wilkinson et al. 2024. TICI: a taxon-independent community index for eDNA-based ecological health assessment. https://doi.org/10.7717/peerj.16963
F785e 16S V5 forward GGATTAGATACCCTGGTA Morey et al. 2006. Species-specific identification of Leptospiraceae by 16S rRNA gene sequencing. https://doi.org/10.1128/JCM.00670-06
907R 16S V5 reverse CCGTCAATTCMTTTRAGTTT Lane et al. 1985. Rapid determination of 16S ribosomal RNA sequences for phylogenetic analyses. https://doi.org/10.1073/pnas.82.20.6955
wilderlab_WV_F 16S forward GACGAGAAGACCCTWTGGAGC 16S_FishSyn_Short_forward Wilkinson et al. 2024. TICI: a taxon-independent community index for eDNA-based ecological health assessment. https://doi.org/10.7717/peerj.16963
wilderlab_WV_R 16S reverse CCRYGGTCGCCCCAAC 16S_FishSyn_Short_reverse Wilkinson et al. 2024. TICI: a taxon-independent community index for eDNA-based ecological health assessment. https://doi.org/10.7717/peerj.16963
16S_FishSyn_Short_forward 16S forward GACGAGAAGACCCTGTGGAGC Nester et al. 2020. Development and evaluation of fish eDNA metabarcoding assays facilitate the detection of cryptic seahorse taxa (family: Syngnathidae). https://doi.org/10.1002/edn3.93
16S_FishSyn_Short_reverse 16S reverse CCGYGGTCGCCCCAAC Nester et al. 2020. Development and evaluation of fish eDNA metabarcoding assays facilitate the detection of cryptic seahorse taxa (family: Syngnathidae). https://doi.org/10.1002/edn3.93
16S_FishSyn_Long_forward 16S forward GACGAGAAGACCCTDTGGAG Nester et al. 2020. Development and evaluation of fish eDNA metabarcoding assays facilitate the detection of cryptic seahorse taxa (family: Syngnathidae). https://doi.org/10.1002/edn3.93
16S_FishSyn_Long_reverse 16S reverse GRATTGCGNTGTTATCCCT Nester et al. 2020. Development and evaluation of fish eDNA metabarcoding assays facilitate the detection of cryptic seahorse taxa (family: Syngnathidae). https://doi.org/10.1002/edn3.93
wilderlab_LG_F 12S forward CGGCGTAAAGWGTGGTTAGG Wilkinson et al. 2024. TICI: a taxon-independent community index for eDNA-based ecological health assessment. https://doi.org/10.7717/peerj.16963
18S_1F 18S forward GCCAGTAGTCATATGCTTGTCT Pochon et al. 2013. Evaluating detection limits of next-generation sequencing for the surveillance and monitoring of international marine pests. https://doi.org/10.1371/journal.pone.0073935
18S_701R 18S reverse GGAGCTGGAATTACCGC Pochon et al. 2013. Evaluating detection limits of next-generation sequencing for the surveillance and monitoring of international marine pests. https://doi.org/10.1371/journal.pone.0073935
18S_400R 18S reverse GCCTGCTGCCTTCCTT Pochon et al. 2013. Evaluating detection limits of next-generation sequencing for the surveillance and monitoring of international marine pests. https://doi.org/10.1371/journal.pone.0073935
SCLER5.8SFor ITS2 scleractinia forward GARTCTTTGAACGCAAATGGC Alexander et al. 2019. Development of a multi-assay approach for monitoring coral diversity using eDNA metabarcoding. https://doi.org/10.1007/s00338-019-01875-9
SCLER28SRev ITS2 scleractinia reverse GCTTATTAATATGCTTAAATTCAGCG Alexander et al. 2019. Development of a multi-assay approach for monitoring coral diversity using eDNA metabarcoding. https://doi.org/10.1007/s00338-019-01875-9
SCLER5.8SFor ITS2 scleractinia forward GARTCTTTGAACGCAAATGGC Alexander et al. 2019. Development of a multi-assay approach for monitoring coral diversity using eDNA metabarcoding. https://doi.org/10.1007/s00338-019-01875-9
Coralacro_874Rev ITS2 scleractinia reverse TCGCCGTTACTGAGGGAATC Alexander et al. 2019. Development of a multi-assay approach for monitoring coral diversity using eDNA metabarcoding. https://doi.org/10.1007/s00338-019-01875-9
Sponge16S_377For 16S porifera forward NGAGTACTGTRAAGGAAAGYTG Alexander et al. 2019. Development of a multi-assay approach for monitoring coral diversity using eDNA metabarcoding. https://doi.org/10.1007/s00338-019-01875-9
Sponge16S_583Rev 16S porifera reverse AGATCACTTGGYTTCGGG Alexander et al. 2019. Development of a multi-assay approach for monitoring coral diversity using eDNA metabarcoding. https://doi.org/10.1007/s00338-019-01875-9
wilderlab_EA_F COI forward TATATAATGTTATTGTAACRGCGC Wilkinson et al. 2024. TICI: a taxon-independent community index for eDNA-based ecological health assessment. https://doi.org/10.7717/peerj.16963
wilderlab_EA_R COI reverse CCCARCATCAAAGGAATCAAYCA Wilkinson et al. 2024. TICI: a taxon-independent community index for eDNA-based ecological health assessment. https://doi.org/10.7717/peerj.16963
wilderlab_ZP_F mt16S forward GGACGATAAGACCCTATAAADCTT Wilkinson et al. 2024. TICI: a taxon-independent community index for eDNA-based ecological health assessment. https://doi.org/10.7717/peerj.16963
wilderlab_ZP_R mt16S reverse CGCTGTTATCCCTAAAGTAAYTT Wilkinson et al. 2024. TICI: a taxon-independent community index for eDNA-based ecological health assessment. https://doi.org/10.7717/peerj.16963
wilderlab_ZC_F mt16S forward GGACGATAAGACCCTATAAADCTT
wilderlab_ZC_R mt16S reverse CGCTGTTATCCCTAAAGTAAYTT
wilderlab_XG_F COI forward GCAATYTCCCAGTATCARACACC Wilkinson et al. 2024. TICI: a taxon-independent community index for eDNA-based ecological health assessment. https://doi.org/10.7717/peerj.16963
wilderlab_XG_R COI reverse GCAGCAAGMACGGGGAG Wilkinson et al. 2024. TICI: a taxon-independent community index for eDNA-based ecological health assessment. https://doi.org/10.7717/peerj.16963
wilderlab_YG_F cytB forward CBGAYATCTCYACCGCYTTYTC Wilkinson et al. 2024. TICI: a taxon-independent community index for eDNA-based ecological health assessment. https://doi.org/10.7717/peerj.16963
wilderlab_YG_R cytB reverse AAAGAAAGATGCGCCRTTRGCATG Wilkinson et al. 2024. TICI: a taxon-independent community index for eDNA-based ecological health assessment. https://doi.org/10.7717/peerj.16963
wilderlab_WG_F 16S venerid clams forward CSCTGTTATCCCYRCGGTA prie_veneroida_F Wilkinson et al. 2024. TICI: a taxon-independent community index for eDNA-based ecological health assessment. https://doi.org/10.7717/peerj.16963
wilderlab_WG_R 16S venerid clams reverse TTDTAAAAGMCGAGAAGACCC prie_veneroida_R Wilkinson et al. 2024. TICI: a taxon-independent community index for eDNA-based ecological health assessment. https://doi.org/10.7717/peerj.16963
wilderlab_DG_F 16S forward TCTTCGGTTGGGGCGAC
wilderlab_DG_R 16S reverse GGATTGCGCTGTTATCCCT
wilderlab_LV_F 12S forward TCGTGCCAGCCRCCGC
wilderlab_LV_R 12S reverse CATAGTGGGGTATCTAATCCCAGTTTG
prie_veneroida_F 16S venerid clams forward CSCTGTTATCCCYRCGGTA Prié et al. 2020. Environmental DNA metabarcoding for freshwater bivalves biodiversity assessment: methods and results for the Western Palearctic (European sub-region). https://doi.org/10.1007/s10750-020-04260-8
prie_veneroida_R 16S venerid clams reverse TTDTAAAAGCCGAGAAGACCC Prié et al. 2020. Environmental DNA metabarcoding for freshwater bivalves biodiversity assessment: methods and results for the Western Palearctic (European sub-region). https://doi.org/10.1007/s10750-020-04260-8
Fung02_F ITS1 fungi forward GGAAGTAAAAGTCGTAACAAGG Epp et al. 2021. New environmental metabarcodes for analysing soil DNA: potential for studying past and present ecosystems https://doi.org/10.1111/j.1365-294x.2012.05537.x
Fung02_R ITS1 fungi reverse CAAGAGATCCGTTGYTGAAAGTK Epp et al. 2021. New environmental metabarcodes for analysing soil DNA: potential for studying past and present ecosystems https://doi.org/10.1111/j.1365-294x.2012.05537.x
MarVer1F 12S mammals forward CGTGCCAGCCACCGCG Valsecchi et al. 2020. Novel universal primers for metabarcoding environmental DNA surveys of marine mammals and other marine vertebrates. https://doi.org/10.1002/edn3.72
MarVer1R 12S mammals reverse GGGTATCTAATCCYAGTTTG Valsecchi et al. 2020. Novel universal primers for metabarcoding environmental DNA surveys of marine mammals and other marine vertebrates. https://doi.org/10.1002/edn3.72
MarVer3F 16S mammals forward AGACGAGAAGACCCTRTG Valsecchi et al. 2020. Novel universal primers for metabarcoding environmental DNA surveys of marine mammals and other marine vertebrates. https://doi.org/10.1002/edn3.72
MarVer3R 16S mammals reverse GGATTGCGCTGTTATCCC Valsecchi et al. 2020. Novel universal primers for metabarcoding environmental DNA surveys of marine mammals and other marine vertebrates. https://doi.org/10.1002/edn3.72